2.8 Western blot analysis
The perR gene was amplified by PCR with primers perR -F
(CGGGATCC ATGGCTGCACAT -GAATTAAA) and perR -R
(CCCTCGAG GTGGTTCTCTTTTTTGGAAC), subcloned into the pET28a vector,
then the recombinant plasmid was transformed into Escherichia
coli BL21. The expression of PerR was induced by IPTG (2 mM), purified
by Ni-NAT column (Qiagen, German), then used for intraperitoneal
immunization of mice at 50 μg/mouse for 3 dosages after emulsification
with Freund’s adjuvant (Sigma, USA) [38]. After one week, the sera
were collected for the following Western blot assay.
The cell pellets were prepared as the method described above for
isolating mRNA. The cell pellets were lyzed by ultrasonification, then
the total proteins concentration of each sample was adjusted to 10
μg/μL. After being mixed with sample buffer, 10 μL of each protein
sample was separated by 15% SDS-PAGE gel, transferred onto the
polyvinylidene fluoride (PVDF) membrane (Millipore, USA), then incubated
with the antisera at a dilution of 400 x for 1 h. After extensive wash,
the membrane was incubated with goat anti-mouse IgG labeled with
Horseradish Peroxidase (HRP) (Boster Biological Technology, China) at a
dilution of 5,000 x for 30 min. After that, the membrane was washed,
reacted with BeyoECL Star (Beyotime Biotechnology, China), then scanned
by Monad QuickChemi 5100 (Zhuhai, China) [38].